View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1703-Insertion-3 (Length: 249)
Name: NF1703-Insertion-3
Description: NF1703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1703-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 9 - 128
Target Start/End: Complemental strand, 38389697 - 38389578
Alignment:
| Q |
9 |
tgactacttaaaacatcaaagtagttataattggctctatttatctcgccttgctgcacttaaagaatttgctttcatgaaggtgcttttactctccctt |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38389697 |
tgactacttaaaacatcgtagtagttataattggctctatttatctcgccttgctgcacttaaagaatttgctttcatgaaggtgcttttactctccctg |
38389598 |
T |
|
| Q |
109 |
gctatatacttgaaatgtta |
128 |
Q |
| |
|
| ||| |||||||| ||||| |
|
|
| T |
38389597 |
gttatgtacttgaattgtta |
38389578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 133 - 248
Target Start/End: Complemental strand, 38389543 - 38389428
Alignment:
| Q |
133 |
gcttgagcaggctttgcacaaacatggctttccagttccggaagctgtggaccgtaatcgacattgtgtaatcatggcacttgttcaaggttatcctctg |
232 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||| || |||||||| | |||||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
38389543 |
gcttgagcaggctttgcaaacacatggctttcctgttccagaggctgtggaacataatcgacattgtgtaatcatgtcgcttgtccaaggttatcctctg |
38389444 |
T |
|
| Q |
233 |
taagtgcccttctttc |
248 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38389443 |
taagtgcccttctttc |
38389428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 131 - 229
Target Start/End: Complemental strand, 34444347 - 34444249
Alignment:
| Q |
131 |
ttgcttgagcaggctttgcacaaacatggctttccagttccggaagctgtggaccgtaatcgacattgtgtaatcatggcacttgttcaaggttatcct |
229 |
Q |
| |
|
||||||||| |||||||||| | |||||||||| | ||||| | |||||||| | |||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
34444347 |
ttgcttgagtaggctttgcaaacacatggcttttcggttccacaggctgtggaacataatcgacattgtgtaatcatgtcgcttgtccaaggttatcct |
34444249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University