View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_high_27 (Length: 269)
Name: NF17030_high_27
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 29403998 - 29403750
Alignment:
| Q |
18 |
aaaaatatgaacaatcaagttcctatttagata----tcacaaggtagagctactcaaataacatgtgttttaactttttaagtttgattgtgcttttat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
29403998 |
aaaaatatgaacaatcaagttcctatttagatagatatcataaggtagagctactcaaataacatgtgttttaacttt--aagtttgattgtgcttatat |
29403901 |
T |
 |
| Q |
114 |
ataatagacaatgttttacatgtggaaggaacctgtgtcaaattttatgtgcttgcgaaaagggggaaatgttcttataaactgagtttggctctaaaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29403900 |
ataatagacaatgttttacatgtggaaggaacctgtgtcaaattttatgtgcttgcaaaatgggggaaatgttcttataaactgagtttggctctaaaat |
29403801 |
T |
 |
| Q |
214 |
aaacaagtccatctaagactgatttgaaatgtattgtaatttcatctcact |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29403800 |
aaacaagtccatctaagactgatttgaaatgtattgtaatttcatctcact |
29403750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University