View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_high_33 (Length: 243)
Name: NF17030_high_33
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 70 - 224
Target Start/End: Complemental strand, 10599710 - 10599560
Alignment:
| Q |
70 |
atcttatatcatggttattaatttataaacaaacactaaccggtaatgtcannnnnnnnnagatgctcgagaacaagcaattttgtgagctgacgttgga |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10599710 |
atcttatatcatggttattaatttataaaca----ctaaccgttaatgtcttttttttttagatgctcgagaacaagcaatttcgtgagctgacgttgga |
10599615 |
T |
 |
| Q |
170 |
aaagaaaacgaccattatcaaggtcattgacgattgcggcaatcggtgggactat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10599614 |
aaagaaaacgaccattatcaaggtcattgacgattgctgcaatcggtgggactat |
10599560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 10599816 - 10599742
Alignment:
| Q |
1 |
tttccaacatgacatgtgttatatatatgtctt--atgctaacaatttcatttgtcagctgatgatgttgaatct |
73 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10599816 |
tttccaacgtgacatgtgttatatatatgtgttttatgctaacaatttcatttgtcagctgatgatgttgaatct |
10599742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 130 - 222
Target Start/End: Original strand, 6254609 - 6254701
Alignment:
| Q |
130 |
agatgctcgagaacaagcaattttgtgagctgacgttggaaaagaaaacgaccattatcaaggtcattgacgattgcggcaatcggtgggact |
222 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| |||||||| ||| ||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
6254609 |
agatgctccaggacaagcaattttgtgagctgatgttggaaaggaagacgaccattatcatggtcattgacgattgcggcaatcggtgagact |
6254701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University