View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_high_36 (Length: 229)
Name: NF17030_high_36
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 12346928 - 12346728
Alignment:
| Q |
15 |
tgaatgtgatgatctagatcattaa----ggatgtatccatgatggttccccaccagttgtatgaagtgtctctagatttggcctctaaggatgatcaag |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
12346928 |
tgaatgtgatgatctagatcattaattaaggatgtatccatgatggttccccacaagttgtatgaagtttctctagatttggcctccaaggatgatcaag |
12346829 |
T |
 |
| Q |
111 |
attcatgaaatggtaaattgttttgatgatgaacaagccaataataaaaacatagagactattgcttgctttcattaattaagatatgctcagttatgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12346828 |
attcatgaaatggtaaattgttttgatgatgaacaagcca---ataaaaacatagaaactattgcttgctttcattaattaagatatgctcagttatgat |
12346732 |
T |
 |
| Q |
211 |
cact |
214 |
Q |
| |
|
|||| |
|
|
| T |
12346731 |
cact |
12346728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 12338550 - 12338365
Alignment:
| Q |
16 |
gaatgtgatgatctagatcattaaggatgtatccatgatggtt--ccccaccagttgtatgaagtgtctctagatttggcctctaaggatgatcaagatt |
113 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| || ||| ||||||||| | || |||| |||| ||||||||||||||||| || | |
|
|
| T |
12338550 |
gaatgtgttgatctagatcatta----tgtatccatgatggtgtgcctcacaagttgtatgcaatggatctatattttgcctctaaggatgatcatgact |
12338455 |
T |
 |
| Q |
114 |
catgaaatggtaaattgttttgatgatgaacaagccaataataaaaacatagagactattgcttgctttcattaattaagatatgctcagtta |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| | |||||||||||| |||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
12338454 |
catgaaatggtaaattgttttgatggtgaacaagcc---agtaaaaacatagaaactattgcttgctttcattaattaggacatgctcagtta |
12338365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 97 - 206
Target Start/End: Complemental strand, 12351128 - 12351021
Alignment:
| Q |
97 |
taaggatgatcaagattcatgaaatggtaaattgttttgatgatgaacaagccaataataaaaacatagagactattg-cttgctttcattaattaagat |
195 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| |||||||||||| |||||||||| ||||||||| ||| |||| || || |||||||||||||| || |
|
|
| T |
12351128 |
taaggatgatcatgatccatgaaatggtaacttgttttgatgaagaacaagcca---ataaaaacagagaaactagtgtctggctttcattaattatgac |
12351032 |
T |
 |
| Q |
196 |
atgctcagtta |
206 |
Q |
| |
|
||||||||||| |
|
|
| T |
12351031 |
atgctcagtta |
12351021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University