View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_high_38 (Length: 222)
Name: NF17030_high_38
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 51844880 - 51844691
Alignment:
| Q |
17 |
cagagaaagagttgttaacaaaactaatggttcttaacgttggaatttgtaaaagagaatcaatgtcaatttttccagagaggcctaaatcagtaagatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51844880 |
cagagaaagagttgttaacaaaactaatggttcttaacgttggaatttgtaaaagagaatcaatgtcaatttttccagagaggcctaaatcggtaagatg |
51844781 |
T |
 |
| Q |
117 |
aagacttgagacgacattgtcgaaacaaatgacaccaacccatcttgaagaacatggattttgattaggaagccatgatgcaagagattg |
206 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844780 |
aagacttgagatgacattgtcgaaacaaatgacaccaacccatcttgaagaacatggattttgattaggaagccatgatgcaagagattg |
51844691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University