View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_high_40 (Length: 207)
Name: NF17030_high_40
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_high_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 2 - 147
Target Start/End: Complemental strand, 39620317 - 39620172
Alignment:
| Q |
2 |
agatcttctaggccattgattttgttcgatttgtctctaacattggcaagaaaacttgcagcttcataatggtgcacgatcttgttatacaatgatgtgg |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||| | |||||||| || ||||||||||||||| ||| |
|
|
| T |
39620317 |
agatcttctaggccattgattttgtttgatttctctctaacgttggcaagaaaacttgcagcttcaaattggtgcacaattttgttatacaatgatttgg |
39620218 |
T |
|
| Q |
102 |
caagttctgtcttccctattcctccaagtccatatatgcccaacat |
147 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
39620217 |
caagttctgttttccctattccaccaagtccatgtatacccaacat |
39620172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 4 - 158
Target Start/End: Original strand, 39581644 - 39581798
Alignment:
| Q |
4 |
atcttctaggccattgattttgttcgatttgtctctaacattggcaagaaaacttgcagcttcataatggtgcacgatcttgttatacaatgatgtggca |
103 |
Q |
| |
|
||||||| |||| ||||||||||| ||||| |||||||||||||||| |||||||||||||||| | |||||||| || ||||||||||||| | ||||| |
|
|
| T |
39581644 |
atcttctgggccgttgattttgtttgatttctctctaacattggcaataaaacttgcagcttcaaattggtgcacaattttgttatacaatgctttggca |
39581743 |
T |
|
| Q |
104 |
agttctgtcttccctattcctccaagtccatatatgcccaacatgcatacagtgt |
158 |
Q |
| |
|
|||||||| || |||||||| || ||||| |||| |||||||| |||| ||||| |
|
|
| T |
39581744 |
agttctgtttttcctattccaccgagtccgcatatacccaacatacatatagtgt |
39581798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 183
Target Start/End: Complemental strand, 39628202 - 39628169
Alignment:
| Q |
150 |
atacagtgtgggagcaagttgtttcaaattgtct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39628202 |
atacagtgtgggagcaagttgtttcaaattgtct |
39628169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University