View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_low_25 (Length: 332)
Name: NF17030_low_25
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 10 - 315
Target Start/End: Complemental strand, 41129572 - 41129268
Alignment:
| Q |
10 |
tagcataggaagaacgtctcgcattcagagtttcaaggttttttgnnnnnnntatggtttatttcccgttaaatgcacgataacagtagactaaaacaat |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41129572 |
tagcattggaagaacgtctcgcattcagagtttcaaggttttt-gaaaaaaatatggtttatttcctgttaaatgcacgataacagtagactaaaacaat |
41129474 |
T |
|
| Q |
110 |
gatttattagttacactattttggatgcaattttgtgcacaggataagagcttgtcaagtggactcttcttcctggagcttctcagtgcagtagagccaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41129473 |
gatttattagttacactattttggatgcaattttgtgtacaggataagagcttgtcaagtggactcttcttcctggagcttctcagtgcagtagagccaa |
41129374 |
T |
|
| Q |
210 |
gggttgtcaactggaacctagtgacaaagggtcaaagtggtatgattccttgcaaatccaatagttaccattgagtttggctaatttttagatatatttc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41129373 |
gggttgtcaactggaacctagtgacaaagggtcaaagtggtatgattccttgcaaatccaatagttaccattgagtttggctaatttttagatatatttc |
41129274 |
T |
|
| Q |
310 |
tttagt |
315 |
Q |
| |
|
|||||| |
|
|
| T |
41129273 |
tttagt |
41129268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University