View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_low_27 (Length: 310)
Name: NF17030_low_27
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 151
Target Start/End: Complemental strand, 1694573 - 1694430
Alignment:
| Q |
8 |
tgataagaatgatgttccagctgtgactgtagtctgatctgattatggcacttcnnnnnnnnnnnnncaaattagcatgatattacaaattttattagag |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
1694573 |
tgataagaatgatgctccagctgtgactgtagtctgatctgattatggcacttcttttttcttttttcaaattagcatgacattacaaattttattagag |
1694474 |
T |
|
| Q |
108 |
gttttatctaggtgannnnnnnacaaatcaggatgacattacaa |
151 |
Q |
| |
|
| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
1694473 |
gatttatctaggtgatttttttacaaattaggatgacattacaa |
1694430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 216 - 283
Target Start/End: Complemental strand, 1694376 - 1694309
Alignment:
| Q |
216 |
tactctcatattccaaggttttattgagaagaattggctattttttacctttcacaacctccatcatg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1694376 |
tactctcatattccaaggttttattgagaagaattggctattttttacctttcacaacctctatcatg |
1694309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 1684081 - 1684034
Alignment:
| Q |
75 |
caaattagcatgatattacaaattttattagaggttttatctaggtga |
122 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1684081 |
caaattaggatgacattacaaattttattagaggttttatctaggtga |
1684034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 61
Target Start/End: Complemental strand, 1684134 - 1684096
Alignment:
| Q |
23 |
tccagctgtgactgtagtctgatctgattatggcacttc |
61 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
1684134 |
tccagttgtgactgcagtctgatctgattatggcacttc |
1684096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University