View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_low_39 (Length: 243)
Name: NF17030_low_39
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 40463360 - 40463525
Alignment:
| Q |
18 |
gttcagattggaagtggaaggggttttacaactta-----tgttgattgataattacttcatagggttaaatcaaatttgcataaagtaaaaccagagac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40463360 |
gttcagattggaagtggaaggggttttacaacttagaatatgttgattgataattacttcatagggttaaatcaaatttgcataaagtaaaaccagagac |
40463459 |
T |
 |
| Q |
113 |
gcgtacataaccatatataatactcacactaaatcagcagcgaataggcatatacaagcatatttc |
178 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40463460 |
gtgtacataaccatatataacactcacactaaatcagcagcgaataggcatatgcaagcatatttc |
40463525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University