View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17030_low_46 (Length: 212)
Name: NF17030_low_46
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17030_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 898663 - 898531
Alignment:
| Q |
10 |
gtcgaagaatatctcagagagtgacatcaaagacgagatgttgtgtaaactttaatgcattggagaaaggttttcttgggggaagagcactaagaacata |
109 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898663 |
gtcgaacaaaatctcagagagtgacatcaaagacgagatgttgtgtaaactttaatgcattggagaaaggttttcttgggggaagagcactaagaacata |
898564 |
T |
|
| Q |
110 |
ggctagtaggaccaaggtttcaatgattcagaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
898563 |
ggctagtaggaccaaggtttcaatgattcagaa |
898531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University