View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17031_high_5 (Length: 493)
Name: NF17031_high_5
Description: NF17031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17031_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 206 - 475
Target Start/End: Original strand, 36962309 - 36962578
Alignment:
| Q |
206 |
ccctcccctactgcatagtgcatacagataatcatgcgcttctatctgtcttttacgtatatttgtgctagcttcaacttcaggattcagatatttgcta |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36962309 |
ccctcccctactgcatagtgcatacagatattcatgtgcttctatctgtcttttgcgtatatttgtgctagcttcaacttcaggattcagatatttgcta |
36962408 |
T |
 |
| Q |
306 |
attttggctggtagattttgtaggattgttttgatttttgaatacttgcatcatggttgtccttagccttcaatatgacaatataaattataattgcagc |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36962409 |
attttggctggtagattttgtaggattgttttgatttttgaatacttgcatcatggttgtccttagccttcaatatgacaatataaattataattgcagc |
36962508 |
T |
 |
| Q |
406 |
tcaaaatattataggatcttgcatctcaaatagagacatattattctctgaaggaagaggaagctgtcac |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36962509 |
tcaaaatattataggatcttgcatctcaaatagacacatattattctctgaaggaagaggaagctgtcac |
36962578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University