View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17031_low_11 (Length: 398)
Name: NF17031_low_11
Description: NF17031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17031_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 199 - 391
Target Start/End: Original strand, 36932912 - 36933104
Alignment:
| Q |
199 |
aaggttgaaaactcgtctaatattttgtttttattgtgcttaccagggcaccaccagcaacgtttcctcgacctgagggtaaactgcagaccatcacttt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36932912 |
aaggttgaaaactcgtctaatattttgtttttattgtgcttaccagggcaccaccagcaacgtttcctcgacctgagggtaaactgcagaccatcacttt |
36933011 |
T |
|
| Q |
299 |
tcctgaggatgtttatgttaagagtttttataaaaaatacccagaatcaaaataccatgatcccatcaagtatggtcttttttcttgtctctg |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36933012 |
tcctgaggatgtttatgttaagagtttttataaaaaatacccagaatcaaaataccatgatcccatcaagtatggtcttttttctcgtctctg |
36933104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 21 - 134
Target Start/End: Original strand, 36932734 - 36932847
Alignment:
| Q |
21 |
tatcacacttaggattatggtgccagagacgttatttttcccagtcttggactatgctatactttttagtttatttatttaggaattctttggatgtcgt |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36932734 |
tatcacacttaggattatggtgctagagacgttatttttcccagtcttgaactatgctatactttttagtttatttatttaggaattctttggatgtcat |
36932833 |
T |
|
| Q |
121 |
gtgtttgctgctga |
134 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36932834 |
gtgtttgctgctga |
36932847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 240 - 372
Target Start/End: Original strand, 990515 - 990647
Alignment:
| Q |
240 |
accagggcaccaccagcaacgtttcctcgacctgagggtaaactgcagaccatcacttttcctgaggatgtttatgttaagagtttttataaaaaatacc |
339 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
990515 |
accagggcaccaccagcaacatttcctcgacctgagggtaaactgcataccatcacttttcctgaagatgtttatgtcaagaggttttataaaaaatacc |
990614 |
T |
|
| Q |
340 |
cagaatcaaaataccatgatcccatcaagtatg |
372 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
990615 |
cagaatcaaaataccatcatcccatcaagtatg |
990647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University