View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17031_low_15 (Length: 296)
Name: NF17031_low_15
Description: NF17031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17031_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 55003027 - 55002748
Alignment:
| Q |
1 |
tgacattggtaataatttgatataatagaaattattggatgtaccacatgcattggcatcatgttaggcacccgatacacattcaatctaaagtgtcaat |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55003027 |
tgacattggtaataatttgataaaatagaaatgattggatgtaccacatgcattggcatcgtgttaggcacccgatacacattcaatctaaagtgtcaat |
55002928 |
T |
 |
| Q |
101 |
gtcgtacatatatgaaaaccaaaaacaagaaatattacctggtatttggttctatagatatcaactgcagctgcatgtgacaggataatattatgggctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55002927 |
gtcgtacatatatgaaaaccaaaaacaagaaatattacctggtatttggttctatagatatcaactgcagctgcatgtgacaggataatattatgggctg |
55002828 |
T |
 |
| Q |
201 |
ctacaaagggctccttttcagaatctccttcgttgcaggttacaattgccaatgaaccagagcaacgacgtggaggaaac |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55002827 |
ctacaaagggctccttttcagaatctccttcgttgcaggttacaattgccaatgaaccagagcaacgacgtggaggaaac |
55002748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 134 - 225
Target Start/End: Complemental strand, 54989366 - 54989275
Alignment:
| Q |
134 |
attacctggtatttggttctatagatatcaactgcagctgcatgtgacaggataatattatgggctgctacaaagggctccttttcagaatc |
225 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||| || ||||| |
|
|
| T |
54989366 |
attacctggtatctgtttctataaatatcaactgcagctgcatgcgataggataatattatgggctgctacaaagggatccttctcggaatc |
54989275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University