View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17031_low_21 (Length: 258)
Name: NF17031_low_21
Description: NF17031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17031_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 29266787 - 29266598
Alignment:
| Q |
19 |
gccaccaccacttatcatcaaaaactctcaactctcaaattcataaaccagtcaccttataaggcctacaaacgtcttcccacctgactctttcattca- |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
29266787 |
gccaccaccacttatcatcaaaaactctcaactctcaaattcataaaccactcaccttataaggcctacaaacgtcttcccacctgactctttgatccac |
29266688 |
T |
|
| Q |
118 |
ccctaattttaaaatctccctaaagaaaaagtatctgaatttgaaccgcggatttccaaactttgacttcatcataaaaatataaagttagaa |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||| | |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29266687 |
ccctaattttgaaatctccctaaagaaaaagtatttgaatttgatcttcggatttccaaactttgact---tcataaaaatataaagttagaa |
29266598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University