View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17031_low_22 (Length: 253)
Name: NF17031_low_22
Description: NF17031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17031_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 40409522 - 40409752
Alignment:
| Q |
1 |
ataaaagagtaaaaactcgacgacgagtgccacgaggtgagcggtgtttatgatttcgcaagtactatagtacaccacagcaaggcaaccataacattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40409522 |
ataaaagagtaaaaactcgacgacgagtgccacgaggtgagcggtgtttatgatttcgcaagtactatagtacaccgcagcaaggcaaccataacattga |
40409621 |
T |
 |
| Q |
101 |
aaagactnnnnnnnccccacgaggttgaaattctggtatcaggaatgcagcctagtatatatttaatgctagcacttgattttgtctgttttatccaatt |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40409622 |
aaagactaaaaaacccccacgaggttgaaattctggtatcaggaatgcagc---gtatatatttaatgctagcacttgattttgtctgttttatccaatt |
40409718 |
T |
 |
| Q |
201 |
ccaacccctaacttgtaagctcacaacaaaattc |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
40409719 |
ccaacccctaacttgtaaactcacaacaaaattc |
40409752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University