View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17031_low_5 (Length: 496)
Name: NF17031_low_5
Description: NF17031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17031_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 6e-38; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 238 - 371
Target Start/End: Complemental strand, 32792240 - 32792104
Alignment:
| Q |
238 |
atatagagtcacaaatttaattaatcttt----acaatttgagagatcattttaaaatactgatgttgtaaaggactaattgatagagctctacaatttc |
333 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||| ||||||||||| || ||||| ||||| |
|
|
| T |
32792240 |
atatagagtgacaaatttaattaatcttttattacaatttgagagatcattttaaaatattgataatgtaaagaactaattgatatagttctac-atttc |
32792142 |
T |
|
| Q |
334 |
atggtccaactttcttttttgatagaatttcagggacc |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32792141 |
atggtccaactttcttttttgatagaatttcaaggacc |
32792104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 62 - 143
Target Start/End: Complemental strand, 32792362 - 32792281
Alignment:
| Q |
62 |
ttaataatttggtctcaagattaagaatatgtagtttggtgtcaaaattgtagaagtttatttgcttagtctttaacattat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32792362 |
ttaataatttggtctcaagattaagaatatgtagtttggtctcaaaattgtagaagtttatttgcttagtctttaacattat |
32792281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 23 - 62
Target Start/End: Complemental strand, 32792768 - 32792729
Alignment:
| Q |
23 |
tcagtgcagaagagaagaagttggtgatgatgccattaat |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32792768 |
tcagtgcagaagagaagaagttggtgatgaagccattaat |
32792729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University