View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17033_high_23 (Length: 265)
Name: NF17033_high_23
Description: NF17033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17033_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 14853894 - 14853659
Alignment:
| Q |
17 |
gggagaagatccattgacgttacccatgaactctactgagatttgggtacaggtccatcaactgcctttcggttttatggacaaaactattggggagcta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14853894 |
gggagaagatccattgacgttacccatgaactctactgaaatttgggtacaggtccatcaactgcctttcggttttatggacaaaactattggggagcta |
14853795 |
T |
 |
| Q |
117 |
gtcggaagtcatattggcaaactagttaaatatgacgaggataacaactatggaccatggcggaaatacatgaggttacgggtggagattgcgttggagg |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14853794 |
gccggaagtcatattggcaaactagttaaatatgacgaggataacaactatggaccatggcggaaatacatgaggttacgggtggagattgcgttggagg |
14853695 |
T |
 |
| Q |
217 |
aaccccttcaacaagatctagtcattgaaagaagtg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14853694 |
aaccccttcaacaagatctagtcattgaaagaagtg |
14853659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University