View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17033_high_33 (Length: 212)
Name: NF17033_high_33
Description: NF17033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17033_high_33 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 47138466 - 47138667
Alignment:
| Q |
1 |
ggaaggaaaccatgcgattttgagcttggtgcaatgcaatgcaatgattgaggaaaagaaaaaggaaaagaagtttagttttgtttgaataataatgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47138466 |
ggaaggaaaccatgcgattttgagcttggtgca----------atgattgaggaaaagaaaaaggaaaagaagtttagttttgtttgaataataatgatt |
47138555 |
T |
 |
| Q |
101 |
attacaaaagaggaagaggaagaggaagagnnnnnnnntcggagaaaaatggaagacaaaggattgaaaataaataacaaccgtgtaacgcgggaatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47138556 |
attacaaaagaggaagaggaagaggaagagaaaaaaaatcggagaaaaatggaagaccaaggattgaaaataaataacaaccgtgtaacgcgggaatcac |
47138655 |
T |
 |
| Q |
201 |
acactcttttct |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47138656 |
acactcttttct |
47138667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University