View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17033_low_19 (Length: 318)
Name: NF17033_low_19
Description: NF17033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17033_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 52549271 - 52549392
Alignment:
| Q |
1 |
ttccttgcctgagacagaattattggtcctccctgt----gtttgaaacaatttctctgttttcatcatgttgacaatcttagttgtaaaattttgcatt |
96 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52549271 |
ttccttgcctgagacagaattattggacctccctgtctgtgtttgaaacaatttctctgttttcatcatgttgacaatcttagttgtaaaattttgcatt |
52549370 |
T |
 |
| Q |
97 |
gccgcctacatcatcataaaat |
118 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52549371 |
gccgcctacatcatcataaaat |
52549392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 272 - 314
Target Start/End: Original strand, 52549549 - 52549591
Alignment:
| Q |
272 |
gtgcgaacatttggttgaactgattatttcaaagaccactatc |
314 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52549549 |
gtgctaacatttggttgaactgattatttcaaagaccactatc |
52549591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 5230184 - 5230088
Alignment:
| Q |
8 |
cctgagacagaattattggtcctccctgtgtttgaaacaatttctctgttttcatcatgttgacaatcttagttgtaaaattttgcattgccgccta |
104 |
Q |
| |
|
||||||||| ||||||||| || ||||| ||||||||||| |||||| |||||||||| | ||||| || || || || |||||||| || ||||| |
|
|
| T |
5230184 |
cctgagacataattattggaccaccctgagtttgaaacaaactctctgctttcatcatggtcacaattttggtggtgaatttttgcatagcagccta |
5230088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University