View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17034_high_39 (Length: 269)
Name: NF17034_high_39
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17034_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 25296358 - 25296111
Alignment:
| Q |
16 |
atacaaagcatcagcaaagaaacttctaactaatcacaacagtggttctcttctcgtagcatgcttcatggattgtagaatttccctccgcaaaagcacc |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296358 |
atacaaagcatcaacaaagaaacttctaactgatcacaacagtggttctcttctcgtagcatgcttcatggattgtagaatttccctccgcaaaagcacc |
25296259 |
T |
 |
| Q |
116 |
tccaggcttgagggaaattcccggctgaaattccaacattccccaccattgctatgcatgggatgcatttgccacatttggcaatgcaccgtggtgggga |
215 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296258 |
tccaggcttgagggaaatacccgactgaaattccaacattccccaccattgctatgcatgggatgcatttgccacatttggcaatgcaccgtggtgggga |
25296159 |
T |
 |
| Q |
216 |
agatcatgggcctgagttggccacaatgcagaagaagatgatgatgat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
25296158 |
agatcatgggcctgagttggccacaatgcagaagaagaagaagatgat |
25296111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University