View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17034_high_42 (Length: 260)
Name: NF17034_high_42
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17034_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 25296047 - 25295980
Alignment:
| Q |
1 |
ttaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgttatattac |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25296047 |
ttaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgtcatattac |
25295980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 173 - 241
Target Start/End: Complemental strand, 25294016 - 25293945
Alignment:
| Q |
173 |
tgtttcagtataatgatctaactgaaaccgtgttcgta---attcaacttttacgaaggaaccctcatcggt |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
25294016 |
tgtttcagtataatgatccaactgaaaccgtgttcgtaaggattcaacttttatgaaggaaccctcatcggt |
25293945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University