View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17034_high_45 (Length: 241)
Name: NF17034_high_45
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17034_high_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 229
Target Start/End: Complemental strand, 40057018 - 40056805
Alignment:
| Q |
17 |
agtttctggattcagattatgcactatgtgttaggtgattggaaattattttttcttttgacagaagataactaggaagttagtgcggtagttattctgt |
116 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40057018 |
agtttgtggattcatattatgcactatgtgttaggtaattggaaattattttttcttttgacagaagataactaggaagttagtgcggtagttattctgt |
40056919 |
T |
|
| Q |
117 |
tatcttctcata-caatgtttaatctccaattgagaggcaagtgaatcttaagacttataaagagatgcaattcattctaatgagaactattcttttcct |
215 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40056918 |
tatcttcttataacaatgtttaatctccaattgagaggcaagtgaatcttaagacttataaagagatgcaattcattctaatgagaactattcttttact |
40056819 |
T |
|
| Q |
216 |
acattattttcttc |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40056818 |
acattattttcttc |
40056805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University