View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17034_low_27 (Length: 392)
Name: NF17034_low_27
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17034_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 10426314 - 10426116
Alignment:
| Q |
20 |
tatctcggttctccacattattctctccttttcttctcacctatcccattttcccttatccttccaccctgtttttctactgtttcttctttacccttgc |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10426314 |
tatctccgttctccacattattctctccttttcttctcacctatcccattttcccttatccttccaccctatttttctactgtttcttctttacccttgc |
10426215 |
T |
 |
| Q |
120 |
gttgagttttgatcgacgaaaaattgatccatggaaaatgtcccttagctttttaaatccgctgaagaagtataggaatctgcttggaggtattattctt |
219 |
Q |
| |
|
||||||||||||||| ||||||| ||||| |||||||||||||| |||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
10426214 |
gttgagttttgatcg---------------atggaaattgtcc-----ctttttaaatccgc-gaagtagtttaggaatctgctgggaggtattattctt |
10426136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 267 - 392
Target Start/End: Complemental strand, 10425498 - 10425372
Alignment:
| Q |
267 |
cttaataaccgtcaaatatcttcccacatagaaacacaatataatccgcttctaattaagacttctactcactcattacccgggattg-aatcgtcctgc |
365 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||| |
|
|
| T |
10425498 |
cttaataaccttcaaatatcttcccacatagaaacacaatataatccgcttctaattaagacttctactcactcattacccaggattgaaatcgtcatgc |
10425399 |
T |
 |
| Q |
366 |
caagccgtcttgaaatcgtgtcactga |
392 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10425398 |
caagccgtcttgaaatcgtgtcactga |
10425372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 91 - 136
Target Start/End: Complemental strand, 37686478 - 37686433
Alignment:
| Q |
91 |
tttttctactgtttcttctttacccttgcgttgagttttgatcgac |
136 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37686478 |
tttttctaccgtttcttctttacccttgcgttgagttttgatcgac |
37686433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 29 - 226
Target Start/End: Original strand, 24819463 - 24819656
Alignment:
| Q |
29 |
tctccacattattctctccttttcttctcac-ctatcccattttcccttatccttccaccctgtttttctactgtttcttctttacccttgcgttgagtt |
127 |
Q |
| |
|
||||||||||||| |||| ||||| |||||| ||||| ||| |||||| ||||||||||||| |||||||| |||||| ||| |||||| || |||||| |
|
|
| T |
24819463 |
tctccacattattttctctttttcctctcactctatcgcatcttccctcatccttccaccctatttttctaaggtttctccttgaccctttcgctgagtt |
24819562 |
T |
 |
| Q |
128 |
ttgatcgacgaaaaattgatccatggaaaatgtcccttagctttttaaatccgctgaagaagtataggaatctgcttggaggtattattcttacattca |
226 |
Q |
| |
|
|||||| ||| |||||||||| | ||||||||||| ||||||||||||||| ||||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
24819563 |
ttgatcaacggaaaattgatcaacggaaaatgtcc-----ctttttaaatccgctcaagaagtttaggaatctgctgcgaggtattattcttatattca |
24819656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 91 - 133
Target Start/End: Original strand, 7497263 - 7497305
Alignment:
| Q |
91 |
tttttctactgtttcttctttacccttgcgttgagttttgatc |
133 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7497263 |
tttttctaccgtttcttctttacccttgcgttgagttttgatc |
7497305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 239
Target Start/End: Complemental strand, 18940976 - 18940915
Alignment:
| Q |
178 |
ccgctgaagaagtataggaatctgcttggaggtattattcttacattcaccgttccaattag |
239 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
18940976 |
ccgctgaagaagatcaggaatctgcaaagaggtattattcttacaatcacccttccaattag |
18940915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University