View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17034_low_42 (Length: 260)

Name: NF17034_low_42
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17034_low_42
NF17034_low_42
[»] chr3 (2 HSPs)
chr3 (1-68)||(25295980-25296047)
chr3 (173-241)||(25293945-25294016)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 5e-28; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 25296047 - 25295980
Alignment:
1 ttaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgttatattac 68  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
25296047 ttaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgtcatattac 25295980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 173 - 241
Target Start/End: Complemental strand, 25294016 - 25293945
Alignment:
173 tgtttcagtataatgatctaactgaaaccgtgttcgta---attcaacttttacgaaggaaccctcatcggt 241  Q
    |||||||||||||||||| |||||||||||||||||||   |||||||||||| ||||||||||||||||||    
25294016 tgtttcagtataatgatccaactgaaaccgtgttcgtaaggattcaacttttatgaaggaaccctcatcggt 25293945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University