View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17034_low_46 (Length: 238)
Name: NF17034_low_46
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17034_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 31 - 221
Target Start/End: Original strand, 36995460 - 36995650
Alignment:
| Q |
31 |
ttagcaaaactctttaaaatttgattgtggaacatactctaaatgtaaaattcattctaaattttatttttaacacagtgtaatgtaaaaatatgacctt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36995460 |
ttagcaaaactctttaaaatttgattgtggatcatactctaaatgtaaaattcattctaaattttatttttaacacagtgtaatgtaaaaatatgacctt |
36995559 |
T |
 |
| Q |
131 |
cttttgaaaggnnnnnnncacttagccttagcattgaatgatttaacgacgggtaatatactcactaattagttaatgataggtggctaac |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36995560 |
cttttgaaaggaaaaaaacacttagccttagcattgaatgatttaacgacgggtaatatactcactaattagttaatgataggtggctaac |
36995650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University