View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17034_low_50 (Length: 212)
Name: NF17034_low_50
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17034_low_50 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 23938909 - 23939121
Alignment:
| Q |
1 |
ttggtatcatatattactttatactaatagacttatcgacaaacttatatttaaaattgaagcttaagaggagacagtgaattgatactagaatagtaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23938909 |
ttggtatcatatattactttatactaatagacttatcgacaaacttatatttaaaaatgaagcttaagaggagatagtgaattgatactagaatagtaga |
23939008 |
T |
 |
| Q |
101 |
ttacttag-aaataatgtctaccttgttaagagtggacaaacagaatcaacatcacttatatgattctttttcttagagaattaattaatattgcctggc |
199 |
Q |
| |
|
|||||||| ||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23939009 |
ttacttagaaaaaaatgtctaccctgttaagaggggacaaacagaatcaacatcacttatatgattctttttcttagagaattaattaatactgcctggc |
23939108 |
T |
 |
| Q |
200 |
atattctgagtcc |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23939109 |
atattctgagtcc |
23939121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University