View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17034_low_51 (Length: 211)
Name: NF17034_low_51
Description: NF17034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17034_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 49482174 - 49481997
Alignment:
| Q |
16 |
atcacaactaatagccactaacannnnnnnnnagaagaaaatattgtggataatgaatttaaacttttcataaacgtgggacatatttcctctcttttta |
115 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49482174 |
atcacaactaataaccactaacatttttttatagaggaaaatattgtggataatgaatttaaacttttcataaacgtgggacatatttcctctcttttta |
49482075 |
T |
 |
| Q |
116 |
tgaaaccaaattgtatattcttctcttcataaaaagaaaatgtatattcttcctttatctttatgaaaaagcgtgttc |
193 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49482074 |
tgaaaccaatttgtatattcttcttgtcataaaaagaaaatgtatattcttcctttttctttatgaaaaagcgtgttc |
49481997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University