View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17035_high_3 (Length: 252)
Name: NF17035_high_3
Description: NF17035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17035_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 52182158 - 52182405
Alignment:
| Q |
1 |
tgaataaagcataaaatcaaaccttggagaattttcatcagagttgatggagcaagatgaatgcaagaatgagcatgcaaaagatggaat----atatca |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
52182158 |
tgaataaagcataaaatcaaaccttggagaattttcatcagagttgatggagcaagatgaatgcaagaatgagcatgcaaaggatggaattaatatatca |
52182257 |
T |
 |
| Q |
97 |
cgggttaaaattgcaagaacgtggttcaagtaaagttcctgaaaaattaaacgccccctcaatgcttagtgcactagtgcctttaattacgtgctctact |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52182258 |
cgggttaaaattgcaagaacgtgggtcaagtaaagttcctgaaaaattaaacgccccctcaatgcttagtgcactagtgcctttaattacgtgctctact |
52182357 |
T |
 |
| Q |
197 |
accactaatctttctcaattatatttctatcttgtatattttcatttc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52182358 |
accactaatctttctcaattatatttctatcttgtatattttcttttc |
52182405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University