View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_high_11 (Length: 306)
Name: NF17036_high_11
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 129 - 293
Target Start/End: Original strand, 43178661 - 43178829
Alignment:
| Q |
129 |
tgaggagaattgaagatcttgagatgagcacactccacttcaagttttcaaaccaacgccgtcagatcaaccaattggattgaaaaatacaag----tat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||| |||||||||||||||||| || |
|
|
| T |
43178661 |
tgaggagaattgaagatcttgagatgagcacactccactccaagttttcaaaccaacgccaccggatcaaccaagtggattgaaaaatacaaggattaat |
43178760 |
T |
 |
| Q |
225 |
taatgtgggtgtattttttgtcgaaattgaaattttcaaagaaaattgtaaacgaccaaattgaatctt |
293 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43178761 |
taatgtggatgtattttttgtcgaaattgaaattttcaaagaaaattgtaaacgaccgaattgaatctt |
43178829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 43176992 - 43177034
Alignment:
| Q |
18 |
cagtgaagaccgattcaattgagaatctcaatcattgaaatct |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43176992 |
cagtgaagaccgattcaattgagaatctcaatcattgatatct |
43177034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University