View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_high_23 (Length: 217)
Name: NF17036_high_23
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 189
Target Start/End: Original strand, 21293984 - 21294168
Alignment:
| Q |
7 |
ggacatcatctgtagctagatgtgagcctaaactgaaccttaaatgttgcttattctatcattttgttgtaccgacaatactatatttatgatattagat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21293984 |
ggacatcatctgtagctagatgtgagcctaaactgaaccttaaatgttgcttattctatcattttgttgtaccgacaatactatatttatgatattagat |
21294083 |
T |
|
| Q |
107 |
attagcgac---tattattattatcagtttcttatggggcttcattattaatctggagaaaatgaccaattgtacgggcccctatg |
189 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21294084 |
attagcgactattattattattatcagtttcttatggggcttca-tattaatctggagaaaatgaccaattgtacggtcccctatg |
21294168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University