View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_high_9 (Length: 324)
Name: NF17036_high_9
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 52860644 - 52860326
Alignment:
| Q |
1 |
ataaacagcacgtaggaagagacaatgagaaagagaagaaggtattgatgagttaaggttgttggaatggagactaagtttacgaagctgtgagagatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860644 |
ataaacagcacgtaggaagagacaatgagaaagagaagaaggtattgatgagttaaggttgttggaatggagactaagtttacgaagctgtgagagatta |
52860545 |
T |
 |
| Q |
101 |
gagagtgatgaagatattgaaccagtgagttgaagacgaggtaaacgtatagtgtgaactctgttattgttgttgtaacagagaatgccatgccaatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860544 |
gagagtgatgaagatattgaaccagtgagttgaagacgaggtaaacgtatagtgtgaactctgttattgttgttgtaacagagaatgccatgccaatcac |
52860445 |
T |
 |
| Q |
201 |
atggtgctgaaggtgttgatggatcccaagttgttaaggcattgagtgggtcaagaaggtttagtttgaagattgttaaggcttggatttcggaatgaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860444 |
atggtgctgaaggtgttgatggatcccaagttgttaaggcattgagtgggtcaagaaggtttagtttgaagattgttaaggcttggatttcggaatgaga |
52860345 |
T |
 |
| Q |
301 |
tgagttgatctgtgctgct |
319 |
Q |
| |
|
||||||||| |||| |||| |
|
|
| T |
52860344 |
tgagttgatttgtgttgct |
52860326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University