View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_low_14 (Length: 283)
Name: NF17036_low_14
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 36638057 - 36637786
Alignment:
| Q |
1 |
gtttggagtcctagatgtctttaacacaaatgtatttctagggtataaagcatatggatttagaatgtttggatggattgcattgatcctaactattgaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36638057 |
gtttggaggcctagatgtctttaacaaaaatgtatttctagggtataaagcataaggatttagaatgtttggatggattgcattgatcctaactattgaa |
36637958 |
T |
 |
| Q |
101 |
tctcaccactaattattttgaattgagttcaaaagtgacgttgtcaatacccatgtctagctctcatctctattgcatagcatgaagtaacccaaatgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| | |
|
|
| T |
36637957 |
tctcaccactaattattttgaattgagttcaaaagtgacgttgtcaatacccatgtctagctctcatctctattgcatagcatgaagcaaaccaaatgac |
36637858 |
T |
 |
| Q |
201 |
ataccttcatgaatgtttaaccttgaccagaaattggagattttttccttgaacgaaaggaaaatgcttctt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36637857 |
ataccttcatgaatgtttaaccttgaccagcaattggagattttttccttgaaggaaaggaaaatgcttctt |
36637786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University