View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_low_16 (Length: 258)
Name: NF17036_low_16
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 153 - 224
Target Start/End: Original strand, 44263183 - 44263254
Alignment:
| Q |
153 |
ttagaaacttttagcatctgctatagatgatcttggttgtttcaatgtagaatagaattattccatagtctt |
224 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44263183 |
ttagaaacttctagcatctgctataaatgatcttggctgtttcaatgtagaatagaattattccatagtctt |
44263254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 227 - 258
Target Start/End: Original strand, 44263278 - 44263309
Alignment:
| Q |
227 |
aatgaagaacttacacagtcctagaacactct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44263278 |
aatgaagaacttacacagtcctagaacactct |
44263309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University