View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_low_20 (Length: 248)
Name: NF17036_low_20
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_low_20 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 35786087 - 35785851
Alignment:
| Q |
17 |
tgctgatggtgctttcttttgcaagggatcaatgagagaggtacagtagagttttcctctttgtctcttctgattttgtggtga-------gttatttaa |
109 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35786087 |
tgcttatggtactttcttttgcaagggatcaatgagag--gtacagtagagttttcctctttgtctcttctgattttgtggtgactggtgagttatttaa |
35785990 |
T |
 |
| Q |
110 |
ttttactttatttttctgttactcagaattgataattcaatgcattgttaattgattaaatcggtttctaaggttttctgatttcttggaatttcaactt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35785989 |
ttttactttatttttctgttactcagaattgataattcaatgcattgttaattgattaaatcggtttctagggttttctgatttcttggaatttcaactt |
35785890 |
T |
 |
| Q |
210 |
tgactgttcggaaatgacaattgatagatagggagtcaa |
248 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35785889 |
tgactgtttggaaatgacaattgatagatagggagtcaa |
35785851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University