View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_low_27 (Length: 202)
Name: NF17036_low_27
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_low_27 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 37864346 - 37864529
Alignment:
| Q |
19 |
gtggagttgaaagcgcaacgaagacatgacctattcgcacgttggattataaagaggaaggttggaggtgagggggtgaaatcaacgagtatggttcagg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37864346 |
gtggagttgaaagcgcaacgaagacatgaactattcacacgttggattataaagaggaaggttggaggtgagggggcgaaatcaacgagtatggttcagg |
37864445 |
T |
|
| Q |
119 |
ggtaagcttgtaatctagaccaggggcgaccaatagggcgtgcgagaggagtgaccacacaaggcactaaaattttaggggcac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
37864446 |
ggtaagcttgtaatctagaccaggggcgaccaatagggcgtgcgagaggagcgaccacacaagccactaaaattttaggggcac |
37864529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University