View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17036_low_8 (Length: 392)
Name: NF17036_low_8
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17036_low_8 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 93 - 392
Target Start/End: Complemental strand, 2421730 - 2421431
Alignment:
| Q |
93 |
tatgttttatgtttataacttttttcttgaaaggatctttacgacttaattgtctctatatatgcaatggtactatcaatcattttattgacagaaaaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2421730 |
tatgttttatgtttataacttttttcttgaaaggatctttacgacttaattgtctctatatatgcaatggtactatcaatcattttattgacagaaaaat |
2421631 |
T |
|
| Q |
193 |
ggtaccgtggatcatnnnnnnntgcaaagatactaaaaaacaaatcttttgagtttcttctttgaagggaacgatcttttgagttgtataagtcacaaat |
292 |
Q |
| |
|
||||||||||||||| ||||||| |||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2421630 |
ggtaccgtggatcataaaaaaatgcaaaggtact-agaaacaaatcttttgagtttcttctttgaagggaacaatcttttgagttgtataagtcacaaat |
2421532 |
T |
|
| Q |
293 |
caaactcaaatctcactatattttctattcggtgatcg-ttttataaaccctttaaattgttttacaaaaatatctttagaaagttgcaatctagcttct |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2421531 |
caaactcaaatctcactatattttctattcggtgatcgtttttataaaccctttaaattgttttacaaaaatatctttagaaagttgcaatctagcttct |
2421432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 2421770 - 2421732
Alignment:
| Q |
19 |
cttctacctaaagtatatatcttaacattaactaaacat |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2421770 |
cttctacctaaagtatatatcttaacattaactaaacat |
2421732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University