View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17039_low_4 (Length: 294)
Name: NF17039_low_4
Description: NF17039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17039_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 45458848 - 45459127
Alignment:
| Q |
1 |
agcactgataattaactaattttagagaacagctaagtataggcatacgcgtataaataaattgtcaaactcaaaactggcccagcaatatgaagaaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45458848 |
agcactgataattaactaattttagagaacagctaagtataggcatacgcgtataaataaattgtcaaactcaaaactggcctagcaatatgaagaaagc |
45458947 |
T |
 |
| Q |
101 |
tccacctttttctcaaattgcgtccaagtaaacctccttaatatttggttgaataaatcacaccctgtctacttgctagagtattggatcacaacccaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45458948 |
tccacctttttctcaaattgcgtccaagtaaacctccttaatatttggttgaataagtcacaccttgtctacttgctagagtattggatcacaacccaaa |
45459047 |
T |
 |
| Q |
201 |
aacaaattatatattactattgatctcttcatttttagctagctaaca--atacaatatcatacacaagtgcctctgtct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45459048 |
aacaaattatatattactattgatctcttcatttctagctagctaacaatatacaatatcatacacaagtgcctctgtct |
45459127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University