View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1703_low_15 (Length: 238)

Name: NF1703_low_15
Description: NF1703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1703_low_15
NF1703_low_15
[»] chr4 (1 HSPs)
chr4 (1-210)||(46406525-46406734)


Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 46406525 - 46406734
Alignment:
1 taatgatttttaaataaacaatgcagtacaagaaacgatatatttttgaattaccacacatgttgcttcaaataaaaggggatatgtagttctgtttatt 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46406525 taatgatttttaaataaacaatgtagtacaagaaacgatatatttttgaattaccacacatgttgcttcaaataaaaggggatatgtagttctgtttatt 46406624  T
101 ctagtattgggagcatgtgtgtgtcactcaatcctattaatcatagtaaaatcactatgattaaaatcaaaccttagaagaaaacaaaattcagaatgaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
46406625 ctagtattgggagcatgtgtgtgtcactcaatcctattaatcatagtaaaatcaccatgattaaaatcaaaccttagaagaaaacaaaattcagaatgaa 46406724  T
201 gtgtttataa 210  Q
    ||||||||||    
46406725 gtgtttataa 46406734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University