View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1703_low_3 (Length: 389)
Name: NF1703_low_3
Description: NF1703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1703_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 4409550 - 4409775
Alignment:
| Q |
15 |
atgaatggtatgcactatgcaataaatcttgatgggatctgtgaaaattaaaaaatgtgcttttgaagtttgggatacttgaattaaaaatattgttaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4409550 |
atgaatggtatgcactatgcaataaatcttgatgggatctgtgaaaattaaaaaatgtgcttttggagtttgggatacttgaattaaaaatattgttaat |
4409649 |
T |
|
| Q |
115 |
gttcatgcatattggaccaatgcatgcttttgatattcacccttttcagcatagttctggttttgttctttacattgttaaacttttaagaccaaattta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409650 |
gttcatgcatattggaccaatgcatgcttttgatattcacccttttcagcatatttctggttttgttctttacattgttaaacttttaagaccaaattta |
4409749 |
T |
|
| Q |
215 |
atgatactctaatcacattgcttatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4409750 |
atgatactctaatcacattgcttatc |
4409775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 271 - 372
Target Start/End: Original strand, 4409806 - 4409907
Alignment:
| Q |
271 |
ctaggttctcataggacaaggcaactacaaatcctgcaaagaagttgtcaaaaatgtttgaatttttgaagattttgacagatatatgtaaagtttcata |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4409806 |
ctaggttctcataggacaaggcaactacaaatcctgcaaagaagttgtcaaaaatgtttgaatttttgaagattttgacagatatatgtaaagtttcata |
4409905 |
T |
|
| Q |
371 |
tg |
372 |
Q |
| |
|
|| |
|
|
| T |
4409906 |
tg |
4409907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University