View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1703_low_5 (Length: 375)
Name: NF1703_low_5
Description: NF1703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1703_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 13 - 358
Target Start/End: Complemental strand, 18513989 - 18513642
Alignment:
| Q |
13 |
aaaatgcaagattctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatga |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18513989 |
aaaaggcaagattctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatga |
18513890 |
T |
|
| Q |
113 |
tatcatgtacaattcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18513889 |
tatcatgtacaattcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacg |
18513790 |
T |
|
| Q |
213 |
gcctgtagaaaactgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcaattgtgaccgcatg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18513789 |
gcctgtagaaaactgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcagttgtgaccgcatg |
18513690 |
T |
|
| Q |
313 |
ttgcagacaactacatgcaactgtaatatt--gcggccgcgtcatgtg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18513689 |
ttgcagacaactacatgcaactgtaatattgcgcggccgcgtcatgtg |
18513642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University