View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1703_low_8 (Length: 280)
Name: NF1703_low_8
Description: NF1703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1703_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 56155724 - 56155983
Alignment:
| Q |
10 |
aagaatatccaatagaaggttatttggactttggaatactagtannnnnnnnataaatatttgatcaaattatatataatgtatcaataaatgtcaacta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56155724 |
aagaatatccaatagaaggttatttggactttggaatactagtattttttttataaacatttgatcaaattatatataatgtatcaataaatgtcaacta |
56155823 |
T |
 |
| Q |
110 |
ttttttactctctcnnnnnnnnnnnnnctatttttcactcat------ggaggaggaagatttagtttttattttatcttattttaatttgcctaccttt |
203 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56155824 |
ttttttactctctcaaaaaaaaaaaaactatttttcactcatggtcatggaggaggaagatttagtttttattttatcttattttaatttgcctaccttt |
56155923 |
T |
 |
| Q |
204 |
ggaaattgatattctcacggtattcccttatcaattttcaatcaaactcaacaccatcaa |
263 |
Q |
| |
|
| ||||||| |||||||| ||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
56155924 |
gaaaattgagattctcactgtattttcttgtcaattttcaatcaaaatcaacaccatcaa |
56155983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University