View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704-Insertion-2 (Length: 411)
Name: NF1704-Insertion-2
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704-Insertion-2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 8 - 411
Target Start/End: Original strand, 51766986 - 51767384
Alignment:
| Q |
8 |
gaattttgggtgtaaattagagagcatatataagactagtattggtgatgatatttgaactcggactcttaacaaatccggtcttttctcttttaagttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51766986 |
gaattttgggtgtaaattagagagcatatataagactagtattggtgatgatatttgaactcggactcttgacaaatccggtcttttctcttttaagttt |
51767085 |
T |
|
| Q |
108 |
ttatatggggctcttgnnnnnnngttcttatcggtttcaacttttcttgcgacaactagaaggggtttgagagcaaattgggcaagtcttggacgaccaa |
207 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51767086 |
ttatatggggctcttgaaaaaaagttattatcggtttcaacttttctggcgacaactagaagaggtttgagagcaaattgggcaagtcttggacgaccaa |
51767185 |
T |
|
| Q |
208 |
aggtccaaattgtgtggcaaannnnnnnggtaggcttccaactcgtggtagcctttgaactaagggtatccttagaggcgggccatactaagaatatgtg |
307 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51767186 |
aggtccaaattgtgtggcaaattttttt-ttaggcttccaactcgtggttgcctttgaactaagggtatccttagaggcgggccatactaagaatatgtg |
51767284 |
T |
|
| Q |
308 |
tttggtgtctgtgagtgagttcaaaacatcgaggaacacttggtttgtatttgtgatttcaccatctcaatgtgatatcagttgttttcattggtgggca |
407 |
Q |
| |
|
|||||||||| ||||||| || ||||||| |||||||||||||||| |||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
51767285 |
tttggtgtct----gtgagtttaagacatcgaagaacacttggtttgtacttgtgatttcactatttcaatgtgatattagttgttttcattggtgggca |
51767380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University