View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1704-Insertion-7 (Length: 149)
Name: NF1704-Insertion-7
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1704-Insertion-7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 8 - 147
Target Start/End: Original strand, 49584480 - 49584619
Alignment:
| Q |
8 |
ggaggaacctagatgttataattatgttccttgtaagaattctatggtcttccttgtccctcgagttaaacagttttcgaggaatctgctgaagggggta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49584480 |
ggaggaacctagatgttataattatgttccttgtaagaattctatggtcttccttgtcccccgagttaaacagttttcaaggaatctgctgaagggggta |
49584579 |
T |
 |
| Q |
108 |
caatatttcgattctccgtttgaaatcctcaacaaagttg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49584580 |
caatatttcgattctccgtttgaaatcctcaataaagttg |
49584619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University