View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17040_low_1 (Length: 254)
Name: NF17040_low_1
Description: NF17040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17040_low_1 |
 |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0154 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 23 - 150
Target Start/End: Original strand, 9609 - 9736
Alignment:
| Q |
23 |
tggcatatgctatatatcatatatcgacccaagaagatggcccacaactacattattgtaaatagagaaacacataaaatacttcttgcaagtcctttag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9609 |
tggcatatgctatatatcatatatcgacccaagaagatggcccacaactacattattgtaaatagagaaacacataaaatacttcttgcaagtccttcag |
9708 |
T |
 |
| Q |
123 |
ttttgtgatttgatccgattaaaattat |
150 |
Q |
| |
|
|||| | ||| |||| ||||||||||| |
|
|
| T |
9709 |
ttttatcgtttaatcctattaaaattat |
9736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 142 - 216
Target Start/End: Original strand, 9920 - 9989
Alignment:
| Q |
142 |
taaaattatataatctgaatctcacaaaaaacctatctacacacactttccctaccaccgttgcagaaatttaac |
216 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
9920 |
taaaattatataatctgaatctaa--aaaaacctatctacacac---ttccctaccaccattgcagaaatttaac |
9989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University