View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17041_high_16 (Length: 312)
Name: NF17041_high_16
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17041_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 160 - 303
Target Start/End: Original strand, 7399223 - 7399366
Alignment:
| Q |
160 |
cacgtggattacaaacctggtgaactgaatttgaattgaacccacatattcgttgagttggttatggtttgcgtatgatgagataaatttgtcaatcaga |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7399223 |
cacgtggattacaaacctggtgaactgaatttgaattgaatccacatattggttgagttggttatggtttgcgtatgatgagataaatttgtcaatcaga |
7399322 |
T |
 |
| Q |
260 |
ataaatggaaccagttgttttagaatgattatcttaatattctt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7399323 |
ataaatggaaccagttgttttagaatgattatcttaattttctt |
7399366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 7399060 - 7399140
Alignment:
| Q |
1 |
ctttttaatttgttgtgtatggtttgtggtgattatttgtttggttaaacttaattcatgaattgaatcgaatcaataatg |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7399060 |
ctttttaatttgttgtgtatggtttgtggtgattatttgtttggttaaacttaattcatgaattgaatcgaatcaataatg |
7399140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University