View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17041_high_19 (Length: 267)
Name: NF17041_high_19
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17041_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 260
Target Start/End: Complemental strand, 37901341 - 37901097
Alignment:
| Q |
16 |
agattcttggggtggatttgtgataggttcttgttcttgaggcttattaactggggttattagctttggaaacatgattgatagcactccacgttcaaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37901341 |
agattcttggggtggatttgtgataggttcttgttcttgaggcttattagctggggttattagctttggaaacatgattgatagcactccacgttcaaac |
37901242 |
T |
 |
| Q |
116 |
ttggcactcacgtcattggtctcacaatatggaggaattggaaattctttgccaaaacgatgccatatattctcaatcccttgtctttcacaattgatcc |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37901241 |
ttggcactcacgtcattggtttcacaatatggaggaattggaaattctttgccaaaacgatgccatatattctcaatcccttgtctttcacaattgatcc |
37901142 |
T |
 |
| Q |
216 |
ttaggacaccttttgaagtcacttgcactctcaattgttcctttg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37901141 |
ttaggacaccttttgaagtcacttgcactctcaattgttcctttg |
37901097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University