View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17041_high_21 (Length: 249)
Name: NF17041_high_21
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17041_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 17 - 177
Target Start/End: Original strand, 12033669 - 12033830
Alignment:
| Q |
17 |
aattagaacataagaaaaacgaagcaattatcaaattaaccttggatttaattttcccttctttccccttttgttgtgttcacataaaa--aatcaaaga |
114 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
12033669 |
aattagaacataagaaaaacggagcaattatcaaattaaccctggatttaattttcccttccttccc-ttttgttgtgttcacaaaaaaaaaatcaaaga |
12033767 |
T |
|
| Q |
115 |
gatgagaactttagagatggtgattggtggctaggcaacgatgcgcagcaatggaggtgggag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
12033768 |
gatgagaactttagagatggtgattggtggctaggaaacgatgcgcatcaatggaggtgggag |
12033830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University