View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17041_high_22 (Length: 248)
Name: NF17041_high_22
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17041_high_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 33495426 - 33495191
Alignment:
| Q |
13 |
ataatgcagtaacaccagaatttaagtcatgtattaacaatcttatctctactgtcgtgttaccaagtgcagctaccgtgccagaatctatggctttgat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495426 |
ataatgcagtaacaccagaatttaagtcatgtattaacaatcttatctctactgtggtgttaccaagtgcagctaccgtgccagaatctatggctttgat |
33495327 |
T |
|
| Q |
113 |
taatgggtttttgggtttttctcataagaattttactaagagattagaagaaagtaaagttaatgcttggattgattcaatgagagctgcttctccaact |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495326 |
taatgggtttttgggtttttctcgtaagaattttactaagagattagaagaaagtaaagttaatgcttggattgattcaatgagagctgcttctccaact |
33495227 |
T |
|
| Q |
213 |
cgtgtcaaatcttcagaaaatcaggaaaaatgttct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495226 |
cgtgtcaaatcttcagaaaatcaggaaaaatgttct |
33495191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 180 - 226
Target Start/End: Complemental strand, 37980434 - 37980388
Alignment:
| Q |
180 |
tggattgattcaatgagagctgcttctccaactcgtgtcaaatcttc |
226 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
| T |
37980434 |
tggattgattctatgagagcttcttctccaactcatgtcaaatcttc |
37980388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University