View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17041_high_27 (Length: 210)
Name: NF17041_high_27
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17041_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 41853057 - 41852874
Alignment:
| Q |
11 |
agcaaaggtagctaggaatttacaagtgtccttgaagttaatattggaactacaatttcagcactttttagcagcatttattttcaaataagtagttgct |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41853057 |
agcaatggtagctaggaatttacaagtgtccttgaagttaatattggaactacaatttcagcactttttagcagcatttattttcaaataagtagttgct |
41852958 |
T |
|
| Q |
111 |
ccaaatttgcattggtacaatttgtgtctcacatgtttagtacaagatcgtcgaaaattcgcaatgataataatgagagctatt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852957 |
ccaaatttgcattggtacaatttgtgtctcacatgtttagtacaagagcgtcgaaaattcgcaatgataataatgagagctatt |
41852874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University