View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17041_high_8 (Length: 420)
Name: NF17041_high_8
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17041_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 182 - 404
Target Start/End: Complemental strand, 42652697 - 42652475
Alignment:
| Q |
182 |
ctcaatgtttcccgttgcgttgtacttggtctcttggctttagtgctaagtcttgacaatgacaataacaatgtaacaccgcagcattaatgcaccaact |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42652697 |
ctcaatgtttcccgttgcgttgtacttggtctcttggctttagtgctaagtcttgacaatgacaataacaatgtaacaccgcagcattaatgcaccaact |
42652598 |
T |
|
| Q |
282 |
acactcaacttccaccttcccaacctttttacgtatattctttcattttaaattacattctttgcatataaaatttttatgcaatattttctctcataca |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42652597 |
acactcaacttccaccttcccaacctttttacgtatattctttcattttaaattacattctttgcatataaaatttttatgcaatattttctctcataca |
42652498 |
T |
|
| Q |
382 |
agaaagaagattaatcataaaag |
404 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
42652497 |
agaaagaagattaatgataaaag |
42652475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 42652860 - 42652786
Alignment:
| Q |
6 |
agcagcacagatgtaagcttaaagaagaagaaaatagtgatgagtcatagattgacataagagtggtggggcact |
80 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42652860 |
agcagcatagatgtaagcttaaagaagaagaaaatagtgatgagtcatagattgacataagagtggtggggcact |
42652786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 100 - 129
Target Start/End: Complemental strand, 42652776 - 42652747
Alignment:
| Q |
100 |
tactaatactacagtttataacactccaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42652776 |
tactaatactacagtttataacactccaat |
42652747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University